CX294328

Overview
NameCX294328
Unique NameCX294328
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length328
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05015C05SK FlavSen1 Citrus clementina cDNA clone C05015C05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294328 ID=CX294328; Name=CX294328; organism=Citrus clementina; type=EST; length=328bp
GCTGGTGGTGCCGTAGCTGCCGCCCCCGCCGCTGAGGAGAAAAAGGAAGA
ACCAAAGGAAGAAAGTGATGATGATATGGGATTCAGTTTGTTTGATTAAA
CACCGCATTCAGTTGAGTCAGAATTTGTTCTCTTCTTATTTTTTTCCTGT
TTTTGTTTTATTGGAATGTAGGACGCAGCTGAGTGGTATAGCTCAGTTTT
TGTTTTTGTTTTAGTTCTATTTCCCGCGGTGTACTTCGACAGTAAGTTTC
TAATCACAAAATGAATATTATCAAAAAAAAAAAAAAAACCTGGGGGGGGG
GCCCGGCCCCCATTTCCCCCTTAAGGGG
back to top