CX294329

Overview
NameCX294329
Unique NameCX294329
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length557
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05015C06SK FlavSen1 Citrus clementina cDNA clone C05015C06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294329 ID=CX294329; Name=CX294329; organism=Citrus clementina; type=EST; length=557bp
ACGAGGGTGGGGACCACCACACTACTGATGTTCACCATCAGCAGCAGTAT
CACGGCGGCGAACACAAGGAAGGCTTGGTGGACAAGATCAAGCAGCAGAT
CCCCGGTGTCGGTACTACTGATGTTCACCATCAGCAGCAGCAGCAGCAGT
ATCACGGCGGGGAACACAGGGAGGGCGAACACAAGGAGGGCTTGGTGGAC
AAGATCAAGCAGAAGATCCCCGGTGTTGGCGGCGGCGAGGGCGCCGCCCA
CGGTGAAGAGAAGAAGAAAAAGAAGAAGGAGAAGAAGAAGCACGAGGACG
GACACGAGAGCAGCAGCAGCAGTGACAGCGATTAAATTAATGAACTTTTA
TGTGACGCATCAACATCAGCATCATCATCCATCATCTTAGATTTATTCTA
TAATAAAAATTGGGTGTGTGTGTGTGTGTGTGGTCACAGTAAGAGCTTGC
TGCTTTATTTTTGGGGTGTCTCCTCAAGGTGGTGTTGTGTTTAATTATTA
TTGCTTTTGAGAGACTCTGTTTTTTTTTATTTATTTTGCCAGTCAGTGTG
TATTTGC
back to top