CX294330

Overview
NameCX294330
Unique NameCX294330
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length563
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05015C07SK FlavSen1 Citrus clementina cDNA clone C05015C07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294330 ID=CX294330; Name=CX294330; organism=Citrus clementina; type=EST; length=563bp
GGGCTGCAGGTTTGTCTGCAAATCTTCTCATCGTTATATCACCAAAGGAA
AACAAAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAGCTGC
AAGTGCGGCGGCGGCTGCGGCGGTAGCGCCATGTACCCTGACTTGAGATC
CTTTGAGAGCACCACCGTCGCCACCGAGACCCTCGTCCTCGGTGTTGCTC
CTGTCAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGAGGGC
GGCTGCAAGTGTGGACCAAACTGCAAGTGCAACCCTTGTAACTGTTAATG
AAGATTACGAGACGTGAACATGCCCCATAATAAAGCAGCGCTGTGAGGTC
GTTTAAATTGTAGTATCAATAAAAAGAACTATTTGTCTTTTGTGGTTGGC
TTTGTTGGATGTCTTTTTATGAGCTTTTGTTTGTAAAATAAAAACCAGCC
ATGGCTGCTTCTCCGAATCCTTAACTGGGTTTGTTGCAGATCCATGGCTA
GTTAATTAATCATTAAGTGTATCTGTTACTGCTGCTTTTCTAATGGGAAG
CTTCCTCTCAGAC
back to top