CX294336

Overview
NameCX294336
Unique NameCX294336
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length448
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05015D03SK FlavSen1 Citrus clementina cDNA clone C05015D03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294336 ID=CX294336; Name=CX294336; organism=Citrus clementina; type=EST; length=448bp
ATAATTTGCGCTCTGTTAGAGTCTTCGTCTACTCTTTGCATTCAGAGCTA
TGCATTCAGAGAATAGCTCATGGCTTCACAGACTCAGTTGTTCACAAGCT
CTTATTGATGTCTTTGGAGTATACATACATGAACTGCATCAAATTCTGCA
CTAGTAGTTGCACATGTTACATAGGTACTACTAGGGTTTGGTTCAGTTCC
TGGCTGGTCTGTCGAGATTTGTCTCATTGCCAAAAAATAGTTGCTGAACG
CTTCAAGAATTAAGGATTTTATAGATCCTGGGACTGGTACACAAATTCAG
ATCAGGTTAGTGCAATCCTGTAAACTTAGAACTAAAACTGAATTGATTCT
TGATGTTTTCTTGTTCATAGCTTTATTTCTCTTTGGAAAAAAAAAATGGT
TTCAGTAGAACTACTTCATTGTAAAGGGTGAACTACTGCGGCTGAATG
back to top