CX294783

Overview
NameCX294783
Unique NameCX294783
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length224
Libraries
Library NameType
FlavSen1cdna_library
Properties
Property NameValue
Genbank descriptionC05055H07SK FlavSen1 Citrus clementina cDNA clone C05055H07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294783 ID=CX294783|Name=CX294783|organism=Citrus clementina|type=EST|length=224bp
GTTTGGAGGACCCAAGTAGATTGCTTTCCGGGCTGGCATCTTATTTTGTT
GTTGGTGAATGGTAACCTTTGTGTGTCACATCTCATGAATCTTGTGCGGC
TCTTACGATTTCTGGGTATGGTATGGATTAGGAATGTTTGGCAGCTGCAT
CTACATATCTGCTGGGAATTTTTCTTTCTGGGTGAAAGGATTGAGTTTAT
GTAGTGGCTTAAAATTTCGTCCTC
back to top