CX294796

Overview
NameCX294796
Unique NameCX294796
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length387
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9896 contig Ccv1_Contig9896:26..412. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056A09SK PhIFruit1 Citrus clementina cDNA clone C05056A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294796 ID=CX294796|Name=CX294796|organism=Citrus clementina|type=EST|length=387bp
TTTCTTTTGAGTTTTGAATACGGTTCAGTCGAAGCCAGCAGAAATCTTTT
GCCTTCCTGATTTGAAGATTATGGGAACTCCTTGCGCAGGTTATACCGAT
TGGTCGGAGGGTGGGGCCCCCCCATGGTTTTCACTTATTGCTGATGATGA
AATTAATGGAAATATTGATCTTCTTGTAGTCCCACAATATGGAAGAAACC
CTGATCACACTGGTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTTT
AAGAAAATAAAAGTATGGGTACTGTTATTACCCGTCAATTGTACGATGGT
CTCAGTTTGGTTCAGTTTAACTTGTAAGATCTCTTGATATATACAAGAGA
TTCTCTTTGTCTAGCTAAAAAAAAAAAAAAAAAAAAA
back to top