CX294806

Overview
NameCX294806
Unique NameCX294806
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length455
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9897 contig Ccv1_Contig9897:78..532. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056B09SK PhIFruit1 Citrus clementina cDNA clone C05056B09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294806 ID=CX294806|Name=CX294806|organism=Citrus clementina|type=EST|length=455bp
TACCTTTTGAGTTTTGAATACGGTTCACCCGAAGCTAGCAAAGATCTTTT
CTCTTTCTGACTTGAAGATCATGGAAACTCCTTGCGCAGGTAATAACGAT
TGGACTGAAAGTTGGGGTGACCCATATCTTGGAAGTGTTGCTGATGATGA
GGTTGTGGATCACAATCTTGATTTTCTTCTGATTTCTCAATATAGAGGGA
ACCCTAATCACGCTGGTTAAATATAAACAGAGTTACTCTTTTGGATGTGT
TATATGTAATAATTGAATAAATGGTGGGCACCGTTCGTTGTCATTACCAG
TCGATGGTTTCGCGTGAATGCCAGTTTGTTTTAGTTTAATTAGTAAGATC
TCTTGAGATATGCAAGAGATTTTCTTTGTTTGTATTCATGCAATTTGTCT
TTCTTAATAAATAAAATTATTGTGCATAGTATGTAATAAAAAAAAAAAAA
AAAAA
back to top