CX294808

Overview
NameCX294808
Unique NameCX294808
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length511
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX294808_ssr35 microsatellite CX294808_ssr35:35..44. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig15148 contig Ccv1_Contig15148:1109..1619. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056B12SK PhIFruit1 Citrus clementina cDNA clone C05056B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294808 ID=CX294808|Name=CX294808|organism=Citrus clementina|type=EST|length=511bp
CTCGTGCCGAATTCGGCACGAGGGCTTGCCGAAGTCTCTCTCTCTGAGGA
GAGGTACCAAGAAGTAAATGCTCTCATCTTTGAAGCCATTGCGCGTGGTG
ATGATGCCAATGGAGGTGTTGCTGAGAGCGTAATTGGGGAGGCAGATGCG
AAACCAAAGTCTGGCGGTGAAGTGGATGCAATTAATAAAAACTCTTGCCC
TGCCATGGTGTCGGGGACTCCAGAATGCCTGGTTCTTCAGTAAGATCCCT
GGCTTGGTGACCAGACCGGTTGTGTTTGTCTGGTTCATGTATGATAGCTT
AAATAAGTGACTGTGTTATGGAGTGTGGCAGTAGCCTAAATAAGCAAACT
TCGTTTGCGCTGCTTTGCGTTTAGTCTAATTTGCCGCCTATGGGCGCTGT
GATGTATGTAAGATATTCTGTTTGCTGATGAGCCTCTCTGTTGATGCTCA
TGGAATTTATTTCTGTATAATTATATGCTGCAGCAGCGGCAGCAGGTATT
GTGGCTTGATG
back to top