CX294809

Overview
NameCX294809
Unique NameCX294809
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length485
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056C01SK PhIFruit1 Citrus clementina cDNA clone C05056C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294809 ID=CX294809|Name=CX294809|organism=Citrus clementina|type=EST|length=485bp
CTCGTGCCGCCTCGTGCCGAATTCAGTACGAGGGCTGGTGCCGAATTTAT
GCACGAGGGACTACAACAGCAGTGAATTTAATCCATTTACTACCTGGTGC
AGATTGTATACACGCATAATACTTATTGTAGCGAATGAACTCGCTGGAGC
TACCATAGTTGGATGCTTTATGGCCTGTGCTTTATAATGTAAAGATAATT
GTTTGAACAAGTGCTCTCGCAAGGTCTTGTGTGACATTCCGAGCATTAAA
TGCCATATACTGGAAGAGCTACTATTGCCATCCGAATATGGCCTATCTGT
GTTATTGTTTTTGACCATATTATACATCTGAATTATCCTTCAAATTTTGA
TCCTCTGCTGGAAAATTCTATTGGATAATATTGTGTTGGTGAAGTTCTGT
CTTAGTAATTTGTATTCTTAATCTTCTTCCGTGATGTGTTATTTTTTTAT
GTACCTGTATTAGTGAAATGCAATCTTCCTTTGTG
back to top