CX294811

Overview
NameCX294811
Unique NameCX294811
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length380
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9300 contig Ccv1_Contig9300:42..421. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05056C04SK PhIFruit1 Citrus clementina cDNA clone C05056C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294811 ID=CX294811|Name=CX294811|organism=Citrus clementina|type=EST|length=380bp
AGCTAGCAAATATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGC
GCAGGTATGAGCGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTAT
TGCTGATGATGATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTC
AATATGGGAGAAATCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATG
ATGATATATATAATTAAATAAAAAGATGGGTACAGTTATTATCTATCAAT
TATAAGAGTGTCAATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAA
GAGATTATCTTTGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAA
TAAAACTATTGTGTAAAAAAAAAAAAAAAA
back to top