CX294951

Overview
NameCX294951
Unique NameCX294951
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length720
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05065A02SK DroRLeaf1 Citrus clementina cDNA clone C05065A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294951 ID=CX294951|Name=CX294951|organism=Citrus clementina|type=EST|length=720bp
GAGGGTGATAAGATGCTGCTTCAATTTTGCAAGCATCTCGTATTGCGAAG
ATTTTGCCCACATGAGATCCCACTATTCTTGACATCAGGGTAACGCAGGC
TGGTGGAGATATTTTTAAAAGGGCATTAACCTACCTTATGGAATTGGAAA
GTTATTATTTCTTGAAAGCAGGCAGCATCTTCGTTGCGTAGGCTTTCCCC
ACTTGATAAGATGCTGACATTGTTACCGGCCCCTTAATTATTTATTAACT
CAGGTTAATAGGGCAAATGTCAGAATGAAGACTGTTCAGTTTAACCCGTA
TAGCAAGGATGATAGCGGTGAGGAAGATTGTTGGCAAGCCAAATAGAGCC
CTCCATTTTGAGAAATATCATCCGCATATTTGAATTGTTGAGCATGTGAA
GTGAACCTTCTTATGGAAATACCTTCCTGTTTGACTTGCAAAATACATTA
CAAAAGCTCCCAAACAGTATATTTGAACAGAGTTACCCATTTTGAGAATT
TTGACTCCCAAACAAGACTGCAGAGTTGTGTATGGTGGGATTAGCTGCAG
GAGCAGTGCAAGATTCTTTGTCAAACTATCTGGCTGGTTATCTGTGACAA
ACCCATCTGTGAGTACTAATGTGCTTGGTTATGGTGCTTTCATTGGACTA
CATGCAAACATGAGATATCAGCTATTGTGTGGATTTGATAGAGACGTCGC
CAACCATTTTGAAGTTATTG
back to top