CX294974

Overview
NameCX294974
Unique NameCX294974
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length403
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9660 contig Ccv1_Contig9660:51..454. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05065C01SK DroRLeaf1 Citrus clementina cDNA clone C05065C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294974 ID=CX294974|Name=CX294974|organism=Citrus clementina|type=EST|length=403bp
GATTCGGCCGAGGCAGATCGGATCCATCTCATACTCTGCAGGAGATTCAG
TCCACCAAGACAATCGATGATCCTGAAATTAAGGCCTGGTTAGCCTTGGG
CATCAAGACTAAGAAGAAAGGTGGTGGAAAGAAGAAGAAAGGTAAGAAGG
GCGACAAAGCTGAGGAATCAACGGAAGCCGAGCCCATGGATGCAACAAAT
GGAGCTGCAACTCAAGAATGAGTGTTTACTTATTTATTTTCATTTCTTTC
CCCAATTTTGATGCTTTGTTCACTTGTATCTGGTTGGTTACAGTTTAATA
TAGTGTTTAGACAATGATTCTAACTGTGTTATCCACCAAATCATATCTGC
ATCCTTCCTCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAA
back to top