CX295022

Overview
NameCX295022
Unique NameCX295022
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length727
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05065G04SK DroRLeaf1 Citrus clementina cDNA clone C05065G04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295022 ID=CX295022; Name=CX295022; organism=Citrus clementina; type=EST; length=727bp
GAGGGCTTCCTGATTTCAAGCTCAAGCTTCAGGCACAATCAATATCCGTT
CAGAGGCAGTTGGGGTGACTCCGACAAAAGCAGATTCCAAAGATGACAAT
CTTGCGTTTGTTGCTGGTGCTACCGGTAAAGTTGGCTCTCGAACAGTAAG
GGAGCTCTTGAAACTTGGTTTTCGAGTTAGAGCTGGAGTCAGGAGTGTTC
AGAGAGCAGAAAATCTTGTCCAGAGTGTTAAGCAAATGAAGCTCGATGGT
GAACTCGCAAACAAAGGAATTCAACCTGTAGAAATGCTTGAACTTGTGGA
ATGTGACTTGGAGAAACGAGGTCAGATTGAACCAGCTTTAGGCAACGCAT
CTGTGGTTATATGTTGCATTGGTGCTAGTGAGAAGGAGGTCTTCGATATT
ACAGGACCTTATAGGATTGACTTCCAGGCTACCAAAAACCTTGTTGATGC
AGGTATGTGCTAAACTTGGTAATTCCAGTTTGATCCAATAATCTTATAGG
AAAAAACAAGAGGATGTAGTGTTTATTACTTGTTCTTGTGATAATTTTCA
CATATGTTATTACTGTTTTTTTTTCCCCTAAGATTTAACACTCTAAAACT
AGAGTGATGCTTCTAACTCTGCAGCAACTATTGCAAAAGTTAACCACTTT
ATCATGGTTTCATCATTGGGAACAAATAAATTTGGATTTCCTGCAGCTAT
TCTAAATTTGTTCTGGGGAGTCCTGCT
back to top