CX295111

Overview
NameCX295111
Unique NameCX295111
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length535
Libraries
Library NameType
DroRLeaf1cdna_library
Properties
Property NameValue
Genbank descriptionC05068F12SK DroRLeaf1 Citrus clementina cDNA clone C05068F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295111 ID=CX295111; Name=CX295111; organism=Citrus clementina; type=EST; length=535bp
GAGGCTTGACAGCTTGCTTAAGGACTCAAATCTTGACTACATTTTTGCCG
GCTGCAGATTGCTAATTAGCTTTGTACTTACAACAACATCGTCAATGGCT
TTATTGTCTAGCATCTTTGGTTGCTTTTCTGATTCAAGCAGGGTCGCAAG
CGAGGGAGAGATAAAAAACACACAGAACAGATCATCAAGCATAGCCGGAG
CGGATGTCGATAGCAAAAGCAAATTAAACAAGAGCAAATCGAAGAAAAGC
CCTCCAATTCCCGTGACTTACTTCCCCATAGGAAGCATACTCTCTCCTTT
ATGAGAAAGCTAAGCATATTCTTTACCAAGTCCGTGCCATTTTCTGCAAG
GACACTTGCGTCGGCAGGCTTGTTTAGCTCGTATTGATTATTACTGTTAA
TTCATGCCTCTCTAGGAACAATCAATTTGTATAAGAATAAGATTTGATTG
TATAGCTCATATAAGATTTATTCTATTTTCCATTTACCACTACTGTGTTC
TTTTTATATATAAAATTAGTTTTGTTGGTCTTGGA
back to top