CX295157

Overview
NameCX295157
Unique NameCX295157
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length410
Libraries
Library NameType
PhIFruit1cdna_library
Properties
Property NameValue
Genbank descriptionC05069B10SK PhIFruit1 Citrus clementina cDNA clone C05069B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295157 ID=CX295157|Name=CX295157|organism=Citrus clementina|type=EST|length=410bp
AGCACAAGTTCTATATGCGCGACGATTGGGTCAAATGAAACAGGGGTTAA
GTATTCCCGGAAGGGAGCGGCCTTTTGATCCAAAGACAGCAAGTCTAGAG
GACTCGGAATTCATCGTTAACATAAAAGTGCCTCTTTTCGACGTTGTTCC
TCCGATTCTTGATTCAATTTTTCGTTCTGCTTGATAACTTCAAAGGACAC
GGTTGGTCTGTTCATTATGCTAACTATAGCTGCCTATAAATAAGAGGGTT
GACCTCAATTGTGTGAGTGAAAGAACTGCTATACTTATGTTCCTTCCTGT
AATAACGAAAGCCTCTTAATTCAGTGTCTCTACTTCTTCAGCAAAATAAA
AATAAATTCTTGATCGAAATNNANAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAA
back to top