CX295159

Overview
NameCX295159
Unique NameCX295159
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length709
Libraries
Library NameType
PhIFruit1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Homology
BLAST of CX295159 vs. ExPASy Swiss-Prot
Match: AMPN_ECOLI (Aminopeptidase N OS=Escherichia coli (strain K12) GN=pepN PE=1 SV=2)

HSP 1 Score: 165.236 bits (417), Expect = 3.051e-40
Identity = 83/192 (43.23%), Postives = 120/192 (62.50%), Query Frame = 2
Query:   32 TLLGSQGFRKGMDLYFKRHDGQAVTCEDFFAAMRDANDAEFANFLLWYSQAGTPRLKVTSSYSAETHTYSLKFGQEVPSTPGQPVKEPMFIPVAIGLLDSSGKDMPLSSVYHNGKLQSLGSNNQPVYTTVLRVTKKEEEFVFSDISERPIPSILRGYSAPIRLESDLSNSDQFFLLANDSDEFNRWEAGQVL 607
            TLLG + F+KGM LYF+RHDG A TC+DF  AM DA++ + ++F  WYSQ+GTP + V   Y+ ET  Y+L   Q  P+TP Q  K+P+ IP AI L D+ GK +PL    H            PV  +VL VT+ E+ FVF ++  +P+P++L  +SAP++LE   S+    FL+ +  ++F+RW+A Q L
Sbjct:  393 TLLGEENFQKGMQLYFERHDGSAATCDDFVQAMEDASNVDLSHFRRWYSQSGTPIVTVKDDYNPETEQYTLTISQRTPATPDQAEKQPLHIPFAIELYDNEGKVIPLQKGGH------------PV-NSVLNVTQAEQTFVFDNVYFQPVPALLCEFSAPVKLEYKWSDQQLTFLMRHARNDFSRWDAAQSL 571          
BLAST of CX295159 vs. ExPASy Swiss-Prot
Match: AMPN_HAEIN (Aminopeptidase N OS=Haemophilus influenzae GN=pepN PE=3 SV=1)

HSP 1 Score: 152.14 bits (383), Expect = 2.673e-36
Identity = 84/202 (41.58%), Postives = 118/202 (58.42%), Query Frame = 2
Query:   32 TLLGSQGFRKGMDLYFKRHDGQAVTCEDFFAAMRDANDAEFANFLLWYSQAGTPRLKVTSSYSAETHTYSLKFGQEVPSTPGQPVKEPMFIPVAIGLLDSSGKDMPLSSVYHNGKLQSLGSNNQPVYTTVLRVTKKEEEFVFSDISERPIPSILRGYSAPIRLESDLSNSDQFFLLANDSDEFNRWEAGQVL-ARKLMLSLV 634
            TLLG QGF+KGM LY   +DG+A TCEDF +AM  AN+ +   F  WYSQ+GTP L ++ +Y  +THTY L   Q  P T  Q  K  + IP+ + L D++G    L    HNG+L S           VL VT+K++ F F  I  RPIP++L  +SAP++L+ D        LL    ++F RW+A Q+L A++L  ++V
Sbjct:  394 TLLGEQGFQKGMQLYIAENDGKAATCEDFVSAMERANNLDLNQFRRWYSQSGTPELLISDAYDEKTHTYRLTVSQSTPPTADQMEKVNLHIPLKVALYDANGTKQMLQ---HNGELLS----------DVLNVTEKDQVFEFHGIYGRPIPALLCDFSAPVKLDYDYKTEQLLGLLKFADNQFIRWDAAQMLFAQELRRNVV 582          
BLAST of CX295159 vs. ExPASy Swiss-Prot
Match: AMPN_CAUCR (Aminopeptidase N OS=Caulobacter crescentus GN=pepN PE=3 SV=2)

HSP 1 Score: 150.984 bits (380), Expect = 5.954e-36
Identity = 79/203 (38.92%), Postives = 115/203 (56.65%), Query Frame = 2
Query:   29 QTLLGSQGFRKGMDLYFKRHDGQAVTCEDFFAAMRDANDAEFANFLLWYSQAGTPRLKVTSSYSAETHTYSLKFGQEVPSTPGQPVKEPMFIPVAIGLLDSSGKDMPLSSVYHNGKLQSLGSNNQPVYTTVLRVTKKEEEFVFSDISERPIPSILRGYSAPIRLESDLSNSDQFFLLANDSDEFNRWEAGQVLARKLMLSLVA 637
            + +LG+  FRKG DLYF+RHDG+A T E F A   +A+  + + F  WY QAGTP + + ++Y A     +L   Q    TPGQP K+P+ IP+AIGLL + G+ +                      T ++ + + +    +  I E P+ S LRG+SAP+ L +D   SD++ L  +D+D FNRWEAGQ LAR L+L+  A
Sbjct:  394 KAILGAPAFRKGCDLYFQRHDGEATTVEAFIACFAEASGRDLSGFFGWYEQAGTPSVTIETAYDAAAGALTLTLTQSTSPTPGQPDKKPLPIPIAIGLLAADGRVLR--------------------DTEIVLLDQAQMTVRWDSIPEPPVLSALRGFSAPVNLSTDARPSDRYVLFGSDTDLFNRWEAGQTLARDLILTRAA 576          
BLAST of CX295159 vs. ExPASy Swiss-Prot
Match: AMP1_PLAFQ (M1 family aminopeptidase OS=Plasmodium falciparum (isolate FcB1 / Columbia) PE=1 SV=2)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 75/214 (35.05%), Postives = 119/214 (55.61%), Query Frame = 2
Query:   32 TLLGSQGFRKGMDLYFKRHDGQAVTCEDFFAAMRDA-------NDAEFANFLLWYSQAGTPRLKVTSSYSAETHTYSLKFGQEVPSTPGQPVKEPMFIPVAIGLLD-SSGKDMPLSSVYHNGKLQSLGSNNQPVYTTVLRVTKKEEEFVFSDISERPIPSILRGYSAPIRLESDLSNSDQFFLLANDSDEFNRWEAGQVLARKLMLSLVADFHK 649
            T+LG + ++KG D+Y K++DG   TCEDF  AM  A       N A    +LLW+SQ+GTP +    +Y AE   YS+   Q       Q  K+P+FIP+++GL++  +GK+M                    +  T L +TK+ + FVF++I+ +PIPS+ RG+SAP+ +E +L++ ++  LL  DSD F R+ +   +  K +L    +F K
Sbjct:  592 TILGEEYYKKGFDIYIKKNDGNTATCEDFNYAMEQAYKMKKADNSANLNQYLLWFSQSGTPHVSFKYNYDAEKKQYSIHVNQYTKPDENQKEKKPLFIPISVGLINPENGKEM--------------------ISQTTLELTKESDTFVFNNIAVKPIPSLFRGFSAPVYIEDNLTDEERILLLKYDSDAFVRYNSCTNIYMKQILMNYNEFLK 785          
The following BLAST results are available for this feature:
BLAST of CX295159 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 4
Match NameE-valueIdentityDescription
AMPN_ECOLI3.051e-4043.23Aminopeptidase N OS=Escherichia coli (strain K12) ... [more]
AMPN_HAEIN2.673e-3641.58Aminopeptidase N OS=Haemophilus influenzae GN=pepN... [more]
AMPN_CAUCR5.954e-3638.92Aminopeptidase N OS=Caulobacter crescentus GN=pepN... [more]
AMP1_PLAFQ1.793e-3235.05M1 family aminopeptidase OS=Plasmodium falciparum ... [more]
back to top
Properties
Property NameValue
Genbank descriptionC05069B12SK PhIFruit1 Citrus clementina cDNA clone C05069B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295159 ID=CX295159|Name=CX295159|organism=Citrus clementina|type=EST|length=709bp
GAGGCCTCGTGCCGAATTCGGCACGAGGCAAACCCTACTTGGGAGTCAAG
GGTTCCGAAAGGGCATGGATCTTTATTTTAAGAGACATGACGGGCAAGCT
GTAACCTGTGAAGATTTTTTTGCAGCCATGCGAGATGCAAATGATGCCGA
ATTTGCTAATTTCTTACTATGGTACTCCCAAGCTGGAACGCCTCGCTTGA
AAGTCACTTCATCCTATAGTGCTGAAACTCATACTTATTCTTTGAAATTC
GGTCAAGAGGTACCATCAACCCCGGGGCAGCCAGTGAAAGAACCCATGTT
CATCCCTGTGGCAATAGGTCTGCTGGACTCAAGTGGCAAGGACATGCCAC
TTTCTTCTGTGTATCATAATGGGAAATTGCAATCTCTTGGAAGCAACAAT
CAGCCAGTCTACACAACAGTTCTTCGAGTAACCAAGAAAGAAGAAGAATT
TGTGTTCTCTGATATATCCGAGCGGCCAATTCCGTCTATCTTGCGGGGTT
ACAGCGCCCCTATTCGCCTTGAATCTGATCTCTCCAATAGTGATCAGTTT
TTCCTCCTTGCTAATGATTCGGATGAGTTCAACCGTTGGGAAGCTGGACA
GGTGTTGGCAAGGAAACTGATGCTCAGCTTGGTGGCTGATTTCCACAAAA
CAACCACTGGTTCTGAATCCAAGTTTGTGCATGGCTTCAGAAGTATGCTT
GGTGATTCA
back to top