CX295161

Overview
NameCX295161
Unique NameCX295161
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length705
Libraries
Library NameType
PhIFruit1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX295161_ssr587 microsatellite CX295161_ssr587:587..598.
Properties
Property NameValue
Genbank descriptionC05069C02SK PhIFruit1 Citrus clementina cDNA clone C05069C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295161 ID=CX295161|Name=CX295161|organism=Citrus clementina|type=EST|length=705bp
GATTCGGCCGAGGAGAATTGCAGCACGCCGGATCTTGTATTTTCGAAGCG
ATTGGGCTTGCTGGCTAACCCAAATTTTGTTTTCCTCAATCGTTCCTCTT
TTCCTGCCAATCATCGCTTTGAAAACTGCCTGAAGCCAAAAAGAAGCGAG
AAATAAGAAGCTCTACAACGGTTCATGTTGGTGAAGGGGCTGAGTTTGTG
TTCCTGCCCATCACCGATTTGAAATCTGCTTGCAGCAAAACAGAAGCGGA
TTTGAAATTTGCCCATCGCCAAGGCGTTCCTCTTTAAATCCATCACTAAA
TACCAATAGATTATTTAATCGGACAAGAAGAAGCTCTACAACAACTTGGT
TGAGGAGAACCAGGCTGTGTTCGTATTCGTGAAGGGGTTTCGGAACAACG
ATACCGGCTGGGCATCAGTGATTCAGGAGTGCCTGAAGCGGAGTACCAGG
TGTTGATCATAAGTTGTTGCTGCTGCCCTCAATCTTATTGATTGGAAGAG
AAGGCAAGGCAAGTTCCAGCCACTGATTCCCCTCCACCGCGTTTGCATTG
TTGTTAATTCCACCAAGTAAGCCTATTTTTGGTATATTTGTTTGTTTGCT
ACAAATAATTTCAACATAAAATTTAATAGAATTGTTTTGTGTCACTTGGG
TTAATGAAGAAATAGAAACTGAACCTTAATTTGGTGCGAAAAAAAAAAAA
AAAAA
back to top