CX295162

Overview
NameCX295162
Unique NameCX295162
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length408
Libraries
Library NameType
PhIFruit1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9298 contig Ccv1_Contig9298:13..420. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05069C03SK PhIFruit1 Citrus clementina cDNA clone C05069C03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295162 ID=CX295162|Name=CX295162|organism=Citrus clementina|type=EST|length=408bp
GAGGCACTACTTACCTTTTGAGTTTTGAATACGGTTCAGTCGAAGCCAGC
AGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAACTCCTTGCGCAG
GTTATAACGATTGGTCGGAGGGGATTGCACCGCCACGTTGGTCACTTATT
GCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTGGTCCCGCAATA
TGGAAGAAACCTTGATCACACTGGTTAAGAATATGCAGTATTAGTCTCTT
ATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACCCATCAAT
TGTATGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGATCTCTTGATA
TATACAAGAGATTCTCTTTGTCTNNNAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAA
back to top