CX295163

Overview
NameCX295163
Unique NameCX295163
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length664
Libraries
Library NameType
PhIFruit1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX295163_ssr191 microsatellite CX295163_ssr191:191..202. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig13529 contig Ccv1_Contig13529:380..1043. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05069C04SK PhIFruit1 Citrus clementina cDNA clone C05069C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295163 ID=CX295163|Name=CX295163|organism=Citrus clementina|type=EST|length=664bp
GAGGGTTATTTGCATATTTGATGCCGAATACTAAGAGTCACCGGAGAGGA
GTACAGGAATCGAGCCGGAGAGCAAGGTTATCGGAGAAATCGTCGTCGTT
TCACGGGGGAATCCCGGCCACTATGCAGACGGATCAGAAGGAGCTCAGAA
GGCCGAAGACTTTACCGGATTTGCTTCAAGATCGTAGCTTTGTCTGTCTG
TCACCGGAATCGAGGCCGAAGAAGCTGACGAAGCTGTTGTTGAACGTCAC
GGTTCAAGGAAGCGTCGGTGCATTACACGTGATAATGTCGCCGGAAAATA
CCGTCGCCGATCTTGCTGCCGCCGCCGTCAAGCAGTACATCAAAGAATGC
CGCCGGCCGATCTTGCCGACCACCGATCCCTCCGGCTTCGACCTCCATTA
CTCTCAGTTTTGCTTGGAAAGTAAGAGTCACATCAAACCATTTTATCTCT
GACCGCTAATTTGTATGCTGAGAAATATCAGGACACGCGTATGGTGGAGG
TTGATGGAATTAAAAATTATTTAATTTTGTTTTGTTTAGGTTTGGGGAGA
GAGGAGAAGCTGATGGAGTTGGGGTCCAGGAACTTCTTTTTATGTCCCAA
AAAGCCGGTGAAAGACGGCTGCAGCAACAGCAGCGACGGAACGACATCGT
CTTCATCGACGTGT
back to top