CX295166

Overview
NameCX295166
Unique NameCX295166
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length380
Libraries
Library NameType
PhIFruit1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9896 contig Ccv1_Contig9896:28..407. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05069C07SK PhIFruit1 Citrus clementina cDNA clone C05069C07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295166 ID=CX295166|Name=CX295166|organism=Citrus clementina|type=EST|length=380bp
CGAGGTGAGTTTTGAATACGGTTCAGTCGAAGCCAGCAGAAATCTTTTGC
CTTCCTGATTTGAAGATTATGGGAACTCCTTGCGCAGGTTATACCGATTG
GTCGGAGGGTGGGGCCCCCCCATGGTTTTCACTTATTGCTGATGATGAAA
TTAATGGAAATATTGATCTTCTTGTAGTCCCACAATATGGAAGAAACCCT
GATCACACTGGTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTTTAA
GAAAATAAAAGTATGGGTACTGTTATTACCCGTCAATTGTACGATGGTCT
CAGTTTGGTTCAGTTTAACTTGTAAGATCTCTTGATATATACAAGAGATT
CTCTTTGTCTAGCTAAAAAAAAAAAAAAAA
back to top