CX295167

Overview
NameCX295167
Unique NameCX295167
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length589
Libraries
Library NameType
PhIFruit1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX295167_ssr280 microsatellite CX295167_ssr280:280..299.
Properties
Property NameValue
Genbank descriptionC05069C08SK PhIFruit1 Citrus clementina cDNA clone C05069C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295167 ID=CX295167|Name=CX295167|organism=Citrus clementina|type=EST|length=589bp
ACGAGGTTGAATTCTCACTGACAAGTCCATTCGGAGGTGGCCGCCCTGGA
AGAGTGAAGAGAAGGAACATCAAGGCTGCTGCCAAGAAGGCCGCAGGTGG
AGATGGAGATGAAGAGGATGAAGAATAAATTACCTGTGTGAACAGATAGT
TTTTTTATGGTTACAGTAGGAATTCTGGCTGAACTTTGCAAGTGGACTTA
TCTTCTCTAAGTTTTATGTTTTTGTTTGCGAATTTTCTTGCTATAATAGG
AGGTTTTGCTTGCTTTGTGTCGCATATCTATAGATAGATAGATAGATAGG
TAGTTTCTGCTCCTGGAGAGTTTCATTTATCGAGAATAAGCTTGGGCTTT
AGATGGGTTTGTAATCAGCTCTCTCATTGGGTGCGACTCGTGCTTGGGCT
TCACGTGGGCTGTTCACACGAGATTAGAATATTTTGCGGTGCTCGCACAC
ACGTGTGAAAAGCGTAGCATAAACATGTGTTCCTTTCACACCTCTTAATA
TTCTTTTAAAATCTCAGTTTGTAAAATTACGTCAAAGTACAAATATAAAT
TTAATTAAACTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top