CX295740

Overview
NameCX295740
Unique NameCX295740
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length748
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1965 contig Ccv1_Contig1965:62..809. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05075D06SK DroRLeaf1 Citrus clementina cDNA clone C05075D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295740 ID=CX295740|Name=CX295740|organism=Citrus clementina|type=EST|length=748bp
GAGGGCTAACAACAGCTAAGTTATCTTTTTCTCTCTTTCTTTTCCTTTTA
TCCTCGCTCCTAAATAGTCCTTGAATCTTTAGATCTGATCCAAATCCAGG
TTTTTTTCTTTGGTTTTTTACTTTCAATCGCTGCCTTCTGTTGGATCTGG
ACTTATGCGAAGTTAGGGTTCTGAAAACAACACCAATGATTCTAGATTTT
CTATGAGTTATTCCGTCCTTATGAAGAGAATTAGAATTCTTCACTCTTTC
TCGGTTGTATTTCTCTACTGGTTCTACGTGTTTTCATGAATTAGAAATCT
CAATTCTCTCGTTTGATCACGCTTTCTAGTATCCAATTATTTTAATCCAT
TTTCTTGTTTGCAACCCTCGATTTCTTAATTGTAAGTAGTTAAATTTATT
AAACTAGAAAAAAAAAAACAAAACAAATTTATGGCTTCAATTCAAAGACA
AGGAAGTTCCGGCTCCGATAGCGACCCGCGATATGCGAACGTTGACGAGC
GGAAAAGGAAGAGGATGATATCGAACCGTGAATCGGCCAGGAGGTCAAGG
ATGAAGAAACAGAAGCAGATGGAGGATTTGGTCAATGAAATCAACCATTT
GGAAAGCGCCAATGCCATGCTTAAGCAAAACATTGATTCATCTGTCCAAC
GCTATGTTGAAATGGAGTCCGCCAACAACATTCTGAGGGTTCAAGCTATG
GAGCTGACTGATCGTTTGCGCTCCTTGACTCTGTCCTCAGATATGGGC
back to top