CX295745

Overview
NameCX295745
Unique NameCX295745
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length455
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05075D11SK DroRLeaf1 Citrus clementina cDNA clone C05075D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295745 ID=CX295745|Name=CX295745|organism=Citrus clementina|type=EST|length=455bp
TATCAGCCGCATTTCCTTTTGATTCAGGATCATCTGAATCAAAAGGAAAT
GGGTCTATAAATATCAGCCGCATATTGACTGGGAAATGCCTTGCTAAAAT
AAGAGCAAGCGATTCCCATTCCCCTTCCCCTGCCTCCAGAATTAGGAGCA
CGGATGCAGAAGCCTTGAAAGACATTACCGCTCTCTTCTATGATGAAGCG
CGTAACGAGATCTACACAGGGAATAAGCACGGTTCAGTTCACGTATGGTC
TAGGAGTTATCAGTGCCGGTCTCTTCTGTGAAAACTCCGCAAACACAAAA
GGCAGTTTCAGGACATGTTATGTTTTAATTGATGGTTTCGGTATACTTTA
TATATAACGGTCATGTATCGTTTTAATTGCGCTGTGGCATCCAAGCACAA
CGCAGGCCCCAAATGGAGAAGAGTTTAAAATTATTCTTTTAAAAAAAAAA
AAAAA
back to top