CX295746

Overview
NameCX295746
Unique NameCX295746
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length731
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05075E01SK DroRLeaf1 Citrus clementina cDNA clone C05075E01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295746 ID=CX295746|Name=CX295746|organism=Citrus clementina|type=EST|length=731bp
GATTCGGCCGAGGCTTGTTTTCAGAATCTGATTTGCAGGTTTTATTGGAT
ACCCTGAAGGCTGTGTATTTTCCTTATGATACCTTTAAACAGAGGTATGG
ACAGATGGAGCGGGCTATCCTATCCTCTGAGATTGCTGGAGTGGATCTAA
GGGGAGCTGTTACTCGTGGTATTGGAGCCCAGGGAATTGAACTCAGTGAG
ACTGTCCGAAGAATGGAAGAGTCTATTCCTCAAGTTATTGTACTTCTTGA
AGCAGCTGTAGAGAGATGCATCAGCTTTACTGGTGGTTCTGAGGCGGATG
AGCTAATTCTAGCACTTGATGACATAATGTTGCAGTACATTTCTACTCTG
CAAGAACTCCTCAAGTCATTAAGAGCCGTCTGTGGAGTCGATCATGATGG
TGTCGGTTCAAAGAAGGAGGTAGGTTTCGACAAAAAGGAGGGAGTATCAA
ATGCACGGAAAGCTGACATCTCAAGTGAAGAGGAGTGGTCCATTGTCCAA
GGGGCTCTGCAGATACTTACTGTTGCAGATTGTCTTACAAGCAGGTCCTC
TGTCTTTGAAGCTTCGTTGAGGGCAACACTTGCTAGACTGAGCACTAGTT
TGTCTCTTTCAGTATTTGGTTCAAGTTTGGACCAAAAGCAATCACAGTCT
GCCAATGTTGATGGCCATGGGGAACTGTCTGTTGGGGGAAGAGCCGCCTT
GGATGTGGCAGCTGTTCGACTTATGATGTCC
back to top