CX295748

Overview
NameCX295748
Unique NameCX295748
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length474
Libraries
Library NameType
DroRLeaf1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10185 contig Ccv1_Contig10185:790..1263. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05075E03SK DroRLeaf1 Citrus clementina cDNA clone C05075E03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295748 ID=CX295748|Name=CX295748|organism=Citrus clementina|type=EST|length=474bp
GAGGGTGGAGAGCTTGAGGCGGTAGTCGTTTGATCACCTGAGTGATAGAT
TCGGTCGTGTGATGTTTCATACAGATATGGTGTTGTTACATATACAAGTC
CTTTTATCATTACAAGAAACTCTATTTCTCCTTGCATGCACGCACAATGT
TTCTTCAAATGCGTGCCTATATAGTGCATTTTCTTGGTTAATTGACTACT
ACTGCTACGCCCGTGAAACTGGATGATGGTATATGATGGCGATAATTTTG
AACAAGTCTCACCTGTAATGTTTCTCTCTTTTATTATATGCTGAGAGATA
CATATTTGCATTTTTTTGTTTGTCTATTGGCTTGGATGCTGAGACTGAGC
TCGGTTTTTTCACACAGCGCCCAGCAAATATGAATATACAATGTGGAGAC
AGTGGTCAACTTGAGATTTTATTTTTTTACGTGACAATAAGAATGAAAAC
TGGCTAAAAAAAAAAAAAAAAAAA
back to top