CX295763

Overview
NameCX295763
Unique NameCX295763
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length693
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05075F06SK DroRLeaf1 Citrus clementina cDNA clone C05075F06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295763 ID=CX295763|Name=CX295763|organism=Citrus clementina|type=EST|length=693bp
ACGAGGCTGCACCTAAAATAGTTTTTCGCTTTATAACCCAAAAGCTTTCC
TCTGTTTCAACAAAGCGAAAATTTACATATATTAAAGCCTGGCTCAAATT
CCTTTTTTCAATCGAAATAAAACGTAGCCACAAAACCCTAATTCACCACA
CCAATTTATCTCTGCCCGGTATTCATTTAAACCCTACCTCGCGGTTCAAT
GTCATTCAATACGATTGCAGATGCCGTTTCAACTTGTCATTTAGTTAGCG
CCATCCAGTTCTCTATGTCACGCTCTGGCTTTGGTGCTATGCTTAGTGCA
TTTTATGGTTTGAAGATTAAGTCATGTTTATTTGATGGCATCGATTCCAT
CGTTGAGGATTGGATTGTTGATCAAGTGCACATAAGGTGGAAACAGGGTA
TGAAAATGTGTTACTGGTGAGGTTGCTGCTTAAGATGAGAATGCATTCTT
TTCAAAAATCCTTGGTTTTCGAGGGGCTCACCGTGGAAGGGATATTGAAT
GACTGGTCTAGGATAAAGCCTATGATTGTGAAAGATTGGAGTGAGAATAT
AGATGCTCGTTTTCATCTTTTTGGCAAGGTCAGAGATGAATGGATAGATA
AGGATTTATTTGACTACTTGGACTGGTGCTAATAGGTCAGAGGCAGTCAG
CTGTGGGGAATCGATATATACACAGATGACTTTGATCTTGTTG
back to top