CX295769

Overview
NameCX295769
Unique NameCX295769
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length674
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15353 contig Ccv1_Contig15353:481..1154. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05075F12SK DroRLeaf1 Citrus clementina cDNA clone C05075F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295769 ID=CX295769|Name=CX295769|organism=Citrus clementina|type=EST|length=674bp
ATCTTTTGATAACAAATACAGTACAAATGGTTCAAGTACAAGTCTATGCA
AATTAGATCAATCTATTAGGACTAAGAACACAACTGAGCTTACTTATAAC
ATTGTCTATGCTCTTCATGGTTTTATGTACAATTTTCCTAGACTGACAAG
AAATTTGAACTTCAACTACTTGTAAAATAGAGGCAATCAAACCCCAAATT
AAGTCAGAATCCGGCCGCAGGCTGGTTTTGGGAAATCAGAGTATTGTGTA
TCAAAAAAGCATACTCAACATATAACAGTAGAAACCAAAAACCCAAATAG
TGAACTGCTGGGAGAGGATTCCTTCAACGGGAATGTCTTCTTTTAGATCT
GACACGGTGATGCATTATCCACAAAACCACCAAAAAGATAATAACGAACG
ACTGCAGAATTACTACCATCTTCACATCTGCAAACACCAGGCTAGACTGC
AGAATTACTACCATCTTCACATCTTTAAGCCTCTCAATCAAGTCCTCCTT
GTTGACTGGAATTTTGGCTCCTCTTGCATCAATAGAGCCAGCATCATTGA
TTGTAGATATGTAACTCTGAGCCTTGTACTCAATATTCCCTCCCATGACA
CAAGTGTTGGGACACTTGATACTGCTATCATACTCGTCACTTCCATCACA
ACAGTCACATATACGATCATTGAC
back to top