CX295777

Overview
NameCX295777
Unique NameCX295777
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length673
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05075G08SK DroRLeaf1 Citrus clementina cDNA clone C05075G08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX295777 ID=CX295777|Name=CX295777|organism=Citrus clementina|type=EST|length=673bp
GAGGCTTATATATTAGAGTTCAGGTTACATCCTAGGTAGACATTTATATA
TTGACACTGCTCGAGGCCTTGGAAGCTCCGATTTACCTGAGGATGCTGAT
CTCATTGACAGGGATGACCAGCAGAAGTTTCTGGCCAGTGTCGATTATCT
TGCCAATTATGGCATGCAGGCAATGATTTCTAATGTTCAGGCAGCAGCAG
ATGAAGCATTGAAGGGAAAGCAATTGAGGGATATCTTTAACACTGCGGTG
CTTCATGAAACTTTCATGCAAATACTTGAGGTGTTCATGAGCATGGGAAG
TCCTCATCAATGGGTGGACTTCTTGATGCCTCAGGATATTAGGTTCTACA
AACTAGTTACAGCCTCCGGTCATGATGAGACAACTCTTTCTGGTGCTACC
AAATTTGATGAACTTATGGTAGAGACACGAGCTGTGTTATCGAGTGCTGA
ATATACGAGTGTTGTTGATATGTCATTCAAAGCGGCAGTGGATGCCCTGA
TAGATGAAATGAGGGTACAATCAGGAGGTAGTCTAATATCAGGGATGCCA
CTGGCTAAACTTGTGCCACGAGTTGTGCAGATGAGTCCATCTCTGCTTGC
GGAGCCAAGCAACAACAGAATTATCCAAGTCATCAGAACCATACCGGAAG
TTGAACTCTTCTTCACTCTCCTC
back to top