CX296268

Overview
NameCX296268
Unique NameCX296268
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length165
Libraries
Library NameType
FerrChloL1cdna_library
Properties
Property NameValue
Genbank descriptionC05138B04SK FerrChloL1 Citrus clementina cDNA clone C05138B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296268 ID=CX296268|Name=CX296268|organism=Citrus clementina|type=EST|length=165bp
CGAGGGATTGACACATCCATTTTCTTCAATGTTTATTTGAACATTTAGTT
AGTTATTCATTGTCATCTACTGATTGATGTGATTCGATGTTGAATGGAAT
CTGCATATTTTGTTACTCCATTGGATAGTTTTAAATGTTCAATATTTAAT
GGTGCAGAACCGAAA
back to top