CX296271

Overview
NameCX296271
Unique NameCX296271
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length710
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9336 contig Ccv1_Contig9336:541..1249. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_WHEAT (Ubiquitin OS=Triticum aestivum PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_SOYBN (Ubiquitin OS=Glycine max GN=SUBI-1 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_SOLTU (Ubiquitin OS=Solanum tuberosum GN=UBI3 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_SOLLC (Ubiquitin OS=Solanum lycopersicum GN=UBI3 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_PETCR (Ubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_PEA (Ubiquitin OS=Pisum sativum GN=PU1 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_ORYSJ (Ubiquitin OS=Oryza sativa subsp. japonica GN=UBQ1 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_NICSY (Ubiquitin OS=Nicotiana sylvestris GN=UBICEP52-7 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_MAIZE (Ubiquitin OS=Zea mays GN=UBF9 PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
BLAST of CX296271 vs. ExPASy Swiss-Prot
Match: UBIQ_LUPPO (Ubiquitin OS=Lupinus polyphyllus PE=3 SV=1)

HSP 1 Score: 139.428 bits (350), Expect = 1.793e-32
Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -3
Query:  499 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 708
            TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:    7 TLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          

HSP 2 Score: 131.339 bits (329), Expect = 4.882e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
Query:  301 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 498
            MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST
Sbjct:    1 MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKEST 66          
The following BLAST results are available for this feature:
BLAST of CX296271 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 95
Match NameE-valueIdentityDescription
UBIQ_WHEAT1.793e-32100.00Ubiquitin OS=Triticum aestivum PE=3 SV=1[more]
UBIQ_SOYBN1.793e-32100.00Ubiquitin OS=Glycine max GN=SUBI-1 PE=3 SV=1[more]
UBIQ_SOLTU1.793e-32100.00Ubiquitin OS=Solanum tuberosum GN=UBI3 PE=3 SV=1[more]
UBIQ_SOLLC1.793e-32100.00Ubiquitin OS=Solanum lycopersicum GN=UBI3 PE=3 SV=... [more]
UBIQ_PETCR1.793e-32100.00Ubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=3... [more]
UBIQ_PEA1.793e-32100.00Ubiquitin OS=Pisum sativum GN=PU1 PE=3 SV=1[more]
UBIQ_ORYSJ1.793e-32100.00Ubiquitin OS=Oryza sativa subsp. japonica GN=UBQ1 ... [more]
UBIQ_NICSY1.793e-32100.00Ubiquitin OS=Nicotiana sylvestris GN=UBICEP52-7 PE... [more]
UBIQ_MAIZE1.793e-32100.00Ubiquitin OS=Zea mays GN=UBF9 PE=3 SV=1[more]
UBIQ_LUPPO1.793e-32100.00Ubiquitin OS=Lupinus polyphyllus PE=3 SV=1[more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionC05138B10SK FerrChloL1 Citrus clementina cDNA clone C05138B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296271 ID=CX296271|Name=CX296271|organism=Citrus clementina|type=EST|length=710bp
GGAATCTCATCTTTTTCATTGCAAAGTAGAACTGCATTGCAAACCGAAAA
ATCAATTATCACACAAATCAAAACCAACATTATAGTAATATATTTAAACT
AGAGTTTTTTATTCAAAAGCATAACTCGTTCAACAAACAACAACATATAA
AAACAAAAGACCATATTATCAATTATAACTAGTCTTCTTCAAGAAGACAA
AGACAACATAAGGACCATCTTGAACAGAAAAGACATTGACACGGGGCGCA
GTGAATCCCCCTCAGAGACCACCACCTCGGAGACGGAGGACGAGATGGAG
GGTGGACTCCTTCTGAATGTTGTAATCAGCCAGAGTACGCCCGTCCTCAA
GCTGCTTCCCAGCGAAGATGAGCCTCTGCTGATCAGGTGGGATCCCTTCC
TTGTCCTGAATCTTGGCTTTGACATTGTCAATGGTATCAGAACTCTCTAC
CTCCAGGGTAATCGTCTTCCCGGTCAATGTCTTAACAAAAATCTGCATGC
CACCCCTCAGACGCAAAACCAGATGAAGAGTTGATTCCTTCTGAATGTTG
TAATCCGCGAGCGTCCTTCCATCCTCCAGCTGCTTGCCAGCGAAGATCAA
ACGCTGCTGGTCCGGCGGAATCCCTTCCTTGTCCTGGATCTTGGCCTTGA
CGTTGTCGATCGTGTCGGAGCTCTCGACTTCGAGGGTAATCGTCTTTCCC
GTTAGGGTTT
back to top