CX296314

Overview
NameCX296314
Unique NameCX296314
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length298
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9302 contig Ccv1_Contig9302:199..497. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05138F12SK FerrChloL1 Citrus clementina cDNA clone C05138F12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296314 ID=CX296314|Name=CX296314|organism=Citrus clementina|type=EST|length=298bp
TATATGTTATGGAATTCCTCAATAATAAATTGCTTTACTTGTATTAGGAA
AGGTCTTCTCAACTCTCTTTGGGGTGTTACAAATTCTGGTATGTGTTAAT
TTTTCTTCTCGCCTTAGCTTTTCTGTACTCTTTTTCATCCTATAAGCATC
TGTCTCTTAAAGGGAGATTGACTGCCTTGTAAGGTATCTCTTATGTAATA
TTTTCCATTTTAATTTTTACTGTTGCAGCATGTGATTCTTGTTTTCTTAT
CAAGGAAAAAAAATAGTGTATTCATCTTAAAAAAAAAAAAAAAAAAAA
back to top