CX296328

Overview
NameCX296328
Unique NameCX296328
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length747
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig685 contig Ccv1_Contig685:1..748. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05138H10SK FerrChloL1 Citrus clementina cDNA clone C05138H10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296328 ID=CX296328|Name=CX296328|organism=Citrus clementina|type=EST|length=747bp
ACGAGGCCTCGTGCCGAATTCGCACGAGGGCGGCATCAGCTTTCAGGTTA
AAATATGGTGCAAGTTCTGTCATTAAGCACGCTAACAACCTCCGGGAATG
GTGGGTTTTATGGGTCACCTGCTTTGTGGAGAAGGCATTTCAAGCTATTA
GAGAAAAGCCGAATTGGGATTGATCGGCCATGCTTTTGTCATCAATTTGT
TCAAGGCTTACACTTAAGAGTTACTTTTAATCTATTAAGACAAAGAAACT
TGAGGGCCAATGCTGGATGGCTGTTTAAAGGAGGTAGTGACCAGGGATTG
GATGCAAGCTCAGAGCGTAGTGAAAGTGCTAACGAGGATATACTGTTTTT
CTTTTTTCAGCTAGATTTGGCAACTCGAGTGCAGTGTGCTTTAAACATGG
AGGAATACGACATTGCACAACAATTGAGAAACAAGCTTACTGAGGTGGAG
GAAGAAATATCTAGGCAGCTAGAAGCGAAAAGGGGATTATCCTCAAAGAG
TGAAGCCCAAGATAAGGCTTTAAGTATCATACGTCTACGTGCAGATCTGC
AGAAAGCAATTGACAGTGAGAATTATGCTTTAGCAGCTGACCTACGGGAT
CAAATTTGCAAACTGGAGGCAGAGTCTTTGGCTGCCTCGGCAACAGCTCT
GGCGTTTGAAAATGCACGATTTGCATTTCGTTTAGGGCAGAAAGTGAATC
ATAAATTTTTGGATATCGAGCTGTGATTTGTGGTATGGATCAGTTTG
back to top