CX296335

Overview
NameCX296335
Unique NameCX296335
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length636
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05139A08SK FerrChloL1 Citrus clementina cDNA clone C05139A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296335 ID=CX296335|Name=CX296335|organism=Citrus clementina|type=EST|length=636bp
CCGAATTCGGCACGAGGCCTCGTGCCGCCTCGTGCCGAATTCGGCGCGAG
GCTATGCTGACATATAAACGCAAGTCCAGCAGCAAATAGCCGCGGAGATT
TCGTAAAAATTTATGTACAAATATAACAAGAGAAATTGGGTAGTTAGAAA
AAAAGAAGAGAAAAAAAAAATGAAAACAAAAGAAGGAAAGAGCTTGCAGG
GTTTACATAACATATAACTAAGCTTGAGACAAAATACAGCCTTCCCATTT
TCCTCTTCCCACCACTTGTTCCGGCAGCACAATAAAACTCAATTATTCTC
TAGCCTGCCTGTTTCACCAACAAGGTTATGTAATCAGAAAAAACAATTAT
TGGAGCGGCTCCTGATGGGGTGTCACGGATGGTCCTGGGGCTATTGTGAA
GTGCAAACCCCGACGTTGCCCTGCCTGAATCATAAATGCAACTTCAGTTG
CCGCAAGTGCTGCTGCTTCCTGTCTTTGTCTTCGACGCTGTAATATACTG
ACAGCCCATGCCATGATGTAACATGGAAGAAGATAACCAGCAGCCCGAAG
CATGATAAGAGAGAAAAATGTAGAAGCATCATCCTCTCCATCATCTGAAT
TGGTGAGGGTCAGAGCATGTCCCAAGAGTAGGAGAG
back to top