CX296387

Overview
NameCX296387
Unique NameCX296387
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length306
Libraries
Library NameType
FerrChloL1cdna_library
Properties
Property NameValue
Genbank descriptionC05140A05SK FerrChloL1 Citrus clementina cDNA clone C05140A05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296387 ID=CX296387|Name=CX296387|organism=Citrus clementina|type=EST|length=306bp
GCCTCGTGCCGAATTCGGCCCGAGGCACGAACCGGTTAGGTGGGTAAGTC
GGTGAATTTTGGCTGGTTGTAACTTGGGGATTAACCAAATTTGAAATAAA
CCTAACAGAAAAACTAGAGGATCTCACCAGGTGATGGCATGCAATGTTAC
TTGAGGAAGTGAACCCGAATGCATAAATTGCAGTTTATTTGATGGGATGC
TGTTATGAATTTATTGGCTGATGAAGAGATTATGATCAGGGGTGTTTAAT
GGTTCAAGTTCAGTGATTTTTGTCCAATTTAAGTTCAATTTTTAAAAAAA
AAAAAA
back to top