CX296388

Overview
NameCX296388
Unique NameCX296388
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length152
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig690 contig Ccv1_Contig690:53..204. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05140A06SK FerrChloL1 Citrus clementina cDNA clone C05140A06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296388 ID=CX296388|Name=CX296388|organism=Citrus clementina|type=EST|length=152bp
GAGGTGATCAGACAAGATTTGGACTGGACGGTAAAGGTGATAGGACACTG
GGAGAAATTGCTGGGAACTTAAATATTTCAAGGGAAATGGTCCGTAAACA
TGAAGTTAAGGGTCTGATGAAACTCAAGCATCCAACCGAGGGGGGGCCCG
GT
back to top