CX296391

Overview
NameCX296391
Unique NameCX296391
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length366
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13916 contig Ccv1_Contig13916:286..652. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionC05140B06SK FerrChloL1 Citrus clementina cDNA clone C05140B06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296391 ID=CX296391|Name=CX296391|organism=Citrus clementina|type=EST|length=366bp
AGGGCCGATCCGGGCGGAAGAATTGTCAGGTGGGGAGTTTGGCTGGGGCG
GCACATCTGTTAAAAGATAACGCAGGTGTCCTAAGATGAGCTCAACGAGA
ACAGAAATCTCGTGTGGAACAAAAGGGTAAAAGCTCGTTTGATTTTGATT
TTCAGTACGAATACGAACCGTGAAAGCGTGGCCTATCGATCCTTTAGACC
TTCGGAATTTGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTG
GCTTGTGGCAGCCAAGCGTTCATAGCGACGTTGCTTTTTGATCCTTCGAT
GTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGTGTTGGATTGT
TCACCCACCAATAGGG
back to top