CX296518

Overview
NameCX296518
Unique NameCX296518
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length241
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05142D01SK FerrChloL1 Citrus clementina cDNA clone C05142D01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296518 ID=CX296518|Name=CX296518|organism=Citrus clementina|type=EST|length=241bp
GCTTTATTGGCTGATGGTTGTTGGATACAGCATTCGAAACATCGAAGTTC
GTTTTGATATGGAAAGAGTTCTCGGCACTCCTCCAAAGCTTGCGGAGTTA
CCTCCAGGAGAAAACATCTAAACATGTACTATGAAACTGCAGATGATAGG
ATTTTATGGCACAGTTAGAGGTCACCAATCTGAATGCTGTACTTTCTGTG
CTACAGAGGCGCTGTAAATTTATTTTACAAAGAAGCTCTAT
back to top