CX296567

Overview
NameCX296567
Unique NameCX296567
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length495
Libraries
Library NameType
FerrChloL1cdna_library
Properties
Property NameValue
Genbank descriptionC05146B11SK FerrChloL1 Citrus clementina cDNA clone C05146B11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296567 ID=CX296567|Name=CX296567|organism=Citrus clementina|type=EST|length=495bp
AGAGGAGGCTATCGGTAGCTTTGATGCATGATCGTGTGTACCTGAAGAAT
ACGAATAGATGTCCCTGAAGAATACAAATAGATGTCATTGGATGTATTGT
AATTCTTTTCTGTTCGAACAAGTTTTGATTAATAGATGAAGATAATGAGA
CTTCAGATTAATCATGCACTAACATCAGCAATTTTATCCCCCCCTCTGCT
TGATCAACCGTATTGTTTGAAGGTCAGGGCTTTGAGTTTCCAAACGTTCT
CAGATTTCATGATCAAAGCCACTATTGCGGGACAGATTCAGGAACTTTTC
TATTTGCATCCTTGTTTAGTGGTGTATGCACATTAATATTGATGTGCAGA
CATTTTCACTTGTCTGACCATTTGTAGGATTTTTCCTAGTTCATTTGATT
TGTGTTAACCCTGTGAAAGTTTTTACGATTTACTTGGGGCTGTTATTCGA
GTAAAACATTTGGAGGTACTTTTTCAAAAAAAGGGGGGGCCCGGT
back to top