CX296570

Overview
NameCX296570
Unique NameCX296570
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length704
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX296570_ssr612 microsatellite CX296570_ssr612:612..626. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig693 contig Ccv1_Contig693:1..704. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05146C02SK FerrChloL1 Citrus clementina cDNA clone C05146C02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296570 ID=CX296570|Name=CX296570|organism=Citrus clementina|type=EST|length=704bp
GAGGGTAAATTCAAATATCATTAGCTGCAGGCTTTTACTCCTCCTCTTCT
GCTTCTTCCAGCCATTTCACAAATGGCTCCAGAGCCTTCACAAAGGTTTG
CCTGCCCTTGGGGTTTGTTCCCTTGCGGAACCAGTAAAGGATTGTATCTT
CCGCCCTCGTGCCGAATTCGGCACGAGGCTAATATTGACTTCAATTCAGA
TGAAGATGGAGCCTTCAACGCCTCGAAGATCATCAAGAAGAAACAGCTTT
TCAAGTCGAAGCAGCAGCCATAGCAAGAACCCATATGCCACAAGCGGGCT
AGACAAGTTCTCTGCACTTTTAGCTGAGCTTGAAGAGAAAAAGCAGAAGA
TTTATTCACGAGTGAACCCAGATGAAATATCTCTTGTTCGTTTTGTGTAC
AAAGATTCGGATGATTGTGTTCCGATTGTGGTCAAGGTGAAGAAAACGGA
CAAGCAGCAGCAAGACAATAACATCAACAATATCAACCAAAGCCAAAGCC
CCCCAAGAAAGCAAGACTCAAATCAATTGAAGGACAAGTTTCCGCTACAG
TCTTCAATTTCATCTCTGGAGAATAAGCAAGGCAATCAGTCAGATCATAA
TAGCAGTAACGAGAAGAAGAAGAAGATGAAGAGGAGCTGGAGCTTTTCTT
TTTCTTGGAGTGATATATTTAAGCTGGGTCATTGGAGGCAGCCTTGTTAT
TATT
back to top