CX296579

Overview
NameCX296579
Unique NameCX296579
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length711
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14432 contig Ccv1_Contig14432:36..746. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05146C12SK FerrChloL1 Citrus clementina cDNA clone C05146C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296579 ID=CX296579|Name=CX296579|organism=Citrus clementina|type=EST|length=711bp
CCGAATTCGGCACGAGGCTCTATTTTCTAAACTACAAAACAAGGAGGATT
CAAAGTCAGCTACTGCTCACAATGAAAATCCCACCAAGGAGCACCACCAG
CCGTCAAACGCTGAGCTCATGGCTAGTGCTAAATGTGTAGCAGAGGCAGC
AAAGGCCACATTCAGCAAAGAATCAGACAAGGTGGACAAGGCCAAAGTTG
CTGGGGCTGCTGAAAATCTTGTGGCTGCTGGTTCCAAATATGGCAACCTT
GAAGAAAACAAGTATGTAGACAAGGCTAAGGATTATCTTCACCAATACCA
CTCTTCTCATTCCACTGCCCAGACCGACACCTCTGGCCACTCAGCCCAAG
GTGGTCATGATTCATCATCAGTTCCATCTGGAGGTGGTGGTGATGAAAAG
TCTGGAGGTGGCTATGGAGACTACCTGAAGACGGCTCAAGGTTTCTTGAA
CAAGTAGTGACTCTTATCTAATAGACTCTAGTATTGTTGATGAGCTAGGA
CAAATAAATAATCTGTTCTGTATGTTTCCTTTTAATTGTGTCTTTTGTTC
TTATAAACTACAAATTTGTGTATTAATGTGTCAACTTTCCAGATTGGGCT
TGCTTGCTAAAGCTAGCCATATCTGTATATGTGCGTGCTTATTGTTAACT
AATGTCATATTGTAATGTTTGGATCATTTACTACTATATCTGCTTCTCTA
AATATGATTTT
back to top