CX296582

Overview
NameCX296582
Unique NameCX296582
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length639
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05146D05SK FerrChloL1 Citrus clementina cDNA clone C05146D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296582 ID=CX296582|Name=CX296582|organism=Citrus clementina|type=EST|length=639bp
GAGGCCTCGTGCCGAATTCGGCACGAGGATTTTGTCTTGCCCTGGAAGCT
ACCTGCCAACGATAACAGCCGTTGAAATTCACCAGATCCAAGTATTCAGC
ATCTAATCATTATCTCCATTTTTGTTCATTCATTTCATTAAAAAAAAAAA
AAAATTTACAGATCGTTAGTTAGCCTTCTCCCTGCGGCGGCGTTTCGCGT
CTACTCAGTATCAGTTCCAACTCCATCTCCATGGGACAGGTTTTAGACAA
ATTTCACGGTAAGGAATGGAGGCAAAAACAGATAAGATTGATTACTGATA
AGGTATACCAGCGCATCAAAAATCAATCTGGAAGGGCAAATTTGGCTTTT
GAAGATCTGTATATTGCTGTCCTCCTTGTGTACAATGATATTAATAAGCA
TCTGCCCGGCCCTCATTTTGATCCACCCTCTAAAGAGCAAGTCAGAGAAA
TGATGAAGGAATGTGATTTGAACCTTGATGGGGAACTCGACCATGAAGAA
TTTGTGAAGTTTATTCAGAAGCTAACATCAGATACCTTTATACTGGTTAG
TCAGGGACTACTCATCACTTTGGTAGTAGCACCAACTGTGGCAATGGCAA
CAAAGAGGGCTACTGAGGGTGTCCCACACGTAGGGAAAG
back to top