CX296588

Overview
NameCX296588
Unique NameCX296588
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length692
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10410 contig Ccv1_Contig10410:43..734. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05146D11SK FerrChloL1 Citrus clementina cDNA clone C05146D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296588 ID=CX296588|Name=CX296588|organism=Citrus clementina|type=EST|length=692bp
AAACAAATCGAGGAGGAAGAAGAGCGAATGGCGACCGGCAAGAGTTACTA
CGCGAGACCGAGCTACAGATTCCTCCAAAGCGACACGCCGAGGGAGGTGC
CGTCGCCGACGTTCGAACTCGATGAGTCGGACTTCTACAACAGCAACTCG
GACAACTCGGCCGAGTTCTCTCGCAAGCCAGGCACTACCGTTTCGGGTTC
TCGGCTCGGGAAGAAACAGATGAAGCGAGCCGATTCTATTGGCGGGACTC
CGGCGTCGGTGCCGGTCAACATACCCGACTGGTCGAAGATTTTGAAGGAC
GAGTATAGGGACAGTCGGAGGAGGGCGGCAGAGGACAGCGACGACGATGA
CGGGTACGGTGGAGGTGAGGATAGCGTGAGGGTCCCGCCGCACGAGTTTT
TGGCGAGGCAGATGGCGAGGACGAGAATCGTTTCCTTTTCGGTTCACGAG
GGCGTGGGCAGGACCTTGAAAGGAGGAGATTTGACAAGGGTCAGAAACGC
AATTTGGGAAAAAACTGGGTTCCAAGATTGAATTTTTGAAAATTTTGTTG
AACGATATCGATCACAAAACCTAGAAAAATAACATTGAGTGAAGATTTAA
TTATAGATTTTACAGTATTTTAAATTTTGACATTTGTAGTTTTTTTTTTT
TTTGGGCTCCGGATCATTTTTATGCTTGTATTCTCTAACTTG
back to top