CX296729

Overview
NameCX296729
Unique NameCX296729
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length199
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig889 contig Ccv1_Contig889:471..669. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05802B07SK FerrChloL1 Citrus clementina cDNA clone C05802B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296729 ID=CX296729|Name=CX296729|organism=Citrus clementina|type=EST|length=199bp
AAGAGGAAAAAATCAAATCGTTTTTTTTTTTTTTTTTCCCCATGTCTCTT
TGGATACGAGTTTTGTGTATACCATAGAAACAATAATTTCCTTATGGAAT
CAAACAAGATTTTCTGTACCTTTCTTTTTTCTGCATTTTCCTCGTGCCGA
ATTCGGCACGAGGCCTCGTGCCGAATTCGGCAGCAAGGGGGGGCCCGGT
back to top