CX296734

Overview
NameCX296734
Unique NameCX296734
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length579
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig643 contig Ccv1_Contig643:80..658. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05802B12SK FerrChloL1 Citrus clementina cDNA clone C05802B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296734 ID=CX296734|Name=CX296734|organism=Citrus clementina|type=EST|length=579bp
CCTCAAATTCAGCGCTTTCTCACTCTTACTAGCAGCGATAATCCTCGCCG
TCCACGTGGCGTCCTCGTCATCTTCGGGCGTTGATTTCGATGGTCTCGGC
CACCAGCTGGGCTTCATTCCGGTGAAATCGGAGTGCCGCGGGTCGATCGC
CGAGTGTATGTCCGTCGAGGGCGACGACGGCGACCAGGAGTTGGATTTGG
AGTTCGCCATGGACGGTGAGATCAACCGGCGCATTTTAGCGATGAGGAGG
TACATCAGCTACGGTGCGCTGAGGAGGAACAGTGTGCCATGCTCGCGGCG
CGGCGCGTCGTATTACAATTGCCGAGCTGGCGGTCAGGCCAATCCTTACT
CTCGCGGGTGCAGTGCTATTACCCGTTGCAGGCGTTGAATTCTCTCTTGA
ATTTGTTATTTTATTTTTCAATTTCAATATTTTTAGTTTATTTTGCAAAA
ATTATTATTTGCAACGTTGTTTTTACGTAATTACGTATAAAGAAGGGAAG
ATTGGGATTGGGGGTTGTTGCGGGAATAAAAGTAATTTGATGTAATTATT
AAAAAAACAAAAAAAAGGGGGGGCCCGGT
back to top