CX296734

Overview
NameCX296734
Unique NameCX296734
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length579
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05802B12SK FerrChloL1 Citrus clementina cDNA clone C05802B12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296734 ID=CX296734; Name=CX296734; organism=Citrus clementina; type=EST; length=579bp
CCTCAAATTCAGCGCTTTCTCACTCTTACTAGCAGCGATAATCCTCGCCG
TCCACGTGGCGTCCTCGTCATCTTCGGGCGTTGATTTCGATGGTCTCGGC
CACCAGCTGGGCTTCATTCCGGTGAAATCGGAGTGCCGCGGGTCGATCGC
CGAGTGTATGTCCGTCGAGGGCGACGACGGCGACCAGGAGTTGGATTTGG
AGTTCGCCATGGACGGTGAGATCAACCGGCGCATTTTAGCGATGAGGAGG
TACATCAGCTACGGTGCGCTGAGGAGGAACAGTGTGCCATGCTCGCGGCG
CGGCGCGTCGTATTACAATTGCCGAGCTGGCGGTCAGGCCAATCCTTACT
CTCGCGGGTGCAGTGCTATTACCCGTTGCAGGCGTTGAATTCTCTCTTGA
ATTTGTTATTTTATTTTTCAATTTCAATATTTTTAGTTTATTTTGCAAAA
ATTATTATTTGCAACGTTGTTTTTACGTAATTACGTATAAAGAAGGGAAG
ATTGGGATTGGGGGTTGTTGCGGGAATAAAAGTAATTTGATGTAATTATT
AAAAAAACAAAAAAAAGGGGGGGCCCGGT
back to top