CX296735

Overview
NameCX296735
Unique NameCX296735
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length484
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10042 contig Ccv1_Contig10042:15..494. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05802C01SK FerrChloL1 Citrus clementina cDNA clone C05802C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296735 ID=CX296735|Name=CX296735|organism=Citrus clementina|type=EST|length=484bp
AAGAGGTTTTCGCCGTTCCTCAAGTATCATATAATCAACTGTTTGTTCCA
ATCTTTCATAAGAATCCGAAAATGGCTGGATCCGGTGGAAGTGTTCCTGC
TCAGGCTACTGATTTCTCCTATGAAGGTGACAATAAGAATGTTATCGCCG
AGAGCCTTGAAGTAGTTCCTGAAGTTGCACCAGAGAAAGTGAACGAGGGA
GACGACAACGGCGGCTGCAAGTGCAACCCATGCAACTGCAACCCGTGTAA
CTGCAGCAAATGAGAGACAGATGCGCCATGCGGCCTATGGAATTAATTAA
CCAGCTGCCTGTTTAAAAGCATATATATGGATCTTTTTTAAATAAGAACT
AATATAGAATCTAAGACCTATGTTTGCTTCTGCTTCAATGGCTTTCTTGT
GAACGTTTGTAGAATATAGAATAGACTACTGTTTTATGTACGAGTCTCCT
CGTGCCGAATTCGGCACGAAGGGGGGGGCCCGGT
back to top