CX296738

Overview
NameCX296738
Unique NameCX296738
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length732
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC05802C04SK FerrChloL1 Citrus clementina cDNA clone C05802C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296738 ID=CX296738|Name=CX296738|organism=Citrus clementina|type=EST|length=732bp
GCCGAATTCGGCACGAGGCATTTAATCCATCGCATACATGAGTGGCTCAA
TATGATCCATCAAATACATAAAAAGAGTTGTTAAGTATAAACTGATTTAC
AATCATCTACTGGTTCCCAGGTCCCAAATAGAAAAGCTTTCTGCATTATG
AATCAAACTCATTCACTAATCGTGTTTTCTGTACCTGAGAGGATATCATC
CATTGACTTGAGTCAAGGCAAAGCTTTCTGTATCTAAAAAGATCATCCAT
TGACTTGAAGGCGAGGCGAAGCAATGAATTGCAGTATCCCAATATCTTGG
AGAATAAAATGCTTCGAGCTGATTCAATTGTTGAACCAAATTAATTTGAA
CCAGAACTTGCAGCACATGAAGCTTGAACATTAGTATCATTCATAGGATT
AGTATCAGCAGTCTCTGATTTTTGCTGGTTGTTCAATTCTGGAACTGAAT
TATTTGAACTGCTTGATACAGAAGTAGTGTTATTACTGTTGCTGTCTCTG
GTTTCTAGACGCTCCATCATACGTGAAACTGTTGAAATTCCAGCATTAAC
CTCCCTTCTAACTTCAGTCCCAAGATCAGCCATGGTATTGTTGCGAGAAA
AAAATCGCTCTTTCCACCCTCTAGTACTCTTTGAAATAGACTCTTTATAC
CTCATTGAGACAGCATTAAATCGAGATTTAAGAGATTCTGAAAATGATTG
GAAATCCGATGGTCCTGCTCTATCCTGACTGT
back to top