CX296742

Overview
NameCX296742
Unique NameCX296742
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length384
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC05802C08SK FerrChloL1 Citrus clementina cDNA clone C05802C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296742 ID=CX296742|Name=CX296742|organism=Citrus clementina|type=EST|length=384bp
GTTGTTCAGGGTATCACTCGGCGAGGGAAAATATGATGAACTCGATGAGA
TTATACGCTCTCCCAGTAATTGGATTCATGTTCATGGCGATACTGCAACT
GGGTAATGCTCAAAACATGGCTCCTTCACCGGCTCCGGCTCCGTCTAGCG
ATGGAACAGCGATCGATCAGGGGATTGCATACATCCTTATGGTGCTGGCG
CTGGCAATTACATACCTGGTGCATTGATTTTGATTCTTTTTCAACTGATT
CTTTTATGTATGTAGTTTTTCTCCACAATCATTTCACTTGGAGAGAAAGT
CACTGCATTATTTGTTATTCTTTGCCCTGTAGCCTTGCCCTATATATGAA
ATTAACTGGTTACTGCAAAAAGGGGGGGCCCGGT
back to top