CX296743

Overview
NameCX296743
Unique NameCX296743
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length570
Libraries
Library NameType
FerrChloL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX296743_ssr233 microsatellite CX296743_ssr233:233..244.
Ccv1_Contig8492 contig Ccv1_Contig8492:9..577. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC05802C09SK FerrChloL1 Citrus clementina cDNA clone C05802C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296743 ID=CX296743|Name=CX296743|organism=Citrus clementina|type=EST|length=570bp
AATCTTATATTGATACAGTAAGAAAAAATCGGGCTCTAAAATTTTCCTTG
TTTTAGGTCTTTTGGTGGCTATTGTTTTCATATCTTCGGAGGTGGCAGCT
AGAGACCTCGCTGAGACTTCCATTGAGCACAAGAAAAATGCTGAGAAGGC
CACTGGGAGAAATGGAGTAAGCGGTGCTAAGTACGGTGGCTATGGTGATC
CTCCTGGCGGCGGTGGTTATGGTGATCCTCCTGGCGGCGGCGGCTATGGT
GATCCTCCTGGCGGCGGTGGCTATGGTAATCCTCGAGGTGGGGGTGTCTA
TCGTAACCCTCGTGGTGGGGGCGTCTACCCTCCTGGCGGTCGGTATTGTC
CCAACGGTTGCTGAGTACCAGTGGTTACAACGGAAGAGGCTGGAGTTTGT
GCTACTCTTTAATTTACTGGAGAGACAGGTGAAGCGAATTGAAGAGTGAA
GCCAAGCCTCACAACTGATTGTGCACCATATACATGCTGAAATAAATCCG
AACTTTATGCCCTTAATCTTATATTTCCAAATAAACACATATTTTAGGTA
ATTTCAAGGGGGGGCCCGGT
back to top