CX296743

Overview
NameCX296743
Unique NameCX296743
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length570
Libraries
Library NameType
FerrChloL1cdna_library
Properties
Property NameValue
Genbank descriptionC05802C09SK FerrChloL1 Citrus clementina cDNA clone C05802C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296743 ID=CX296743; Name=CX296743; organism=Citrus clementina; type=EST; length=570bp
AATCTTATATTGATACAGTAAGAAAAAATCGGGCTCTAAAATTTTCCTTG
TTTTAGGTCTTTTGGTGGCTATTGTTTTCATATCTTCGGAGGTGGCAGCT
AGAGACCTCGCTGAGACTTCCATTGAGCACAAGAAAAATGCTGAGAAGGC
CACTGGGAGAAATGGAGTAAGCGGTGCTAAGTACGGTGGCTATGGTGATC
CTCCTGGCGGCGGTGGTTATGGTGATCCTCCTGGCGGCGGCGGCTATGGT
GATCCTCCTGGCGGCGGTGGCTATGGTAATCCTCGAGGTGGGGGTGTCTA
TCGTAACCCTCGTGGTGGGGGCGTCTACCCTCCTGGCGGTCGGTATTGTC
CCAACGGTTGCTGAGTACCAGTGGTTACAACGGAAGAGGCTGGAGTTTGT
GCTACTCTTTAATTTACTGGAGAGACAGGTGAAGCGAATTGAAGAGTGAA
GCCAAGCCTCACAACTGATTGTGCACCATATACATGCTGAAATAAATCCG
AACTTTATGCCCTTAATCTTATATTTCCAAATAAACACATATTTTAGGTA
ATTTCAAGGGGGGGCCCGGT
back to top