CX296834

Overview
NameCX296834
Unique NameCX296834
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length335
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11891 contig Ccv1_Contig11891:945..1279. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05803D01SK FerrChloL1 Citrus clementina cDNA clone C05803D01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296834 ID=CX296834|Name=CX296834|organism=Citrus clementina|type=EST|length=335bp
GAGGCCTCGCGCCGAATTCGGCACGAGGCAGCAACACACAGTAATGACCC
ATACATTGATGATTATTACCACCAGGCCTGTCTGGCCAAAAAATATGCTG
GTGCAAAGCTTAAACATCATTTCTGCCCAACACACTTGAGGGATCTTCCT
CCACGAGCACGTGCAAATACTGAGCCACATGCTTTTCTCCAGGTTGATGC
TCTTGGGAGGGTTCCATTCTCTTCAATTCGTAGGCCTCGCCCTCTTCTTG
AAGTTGATCCTCCAAATTCACAGAGTTCTGGAAACACGGAGCAGAAAATT
ACTGAGAAGCCCCTGGAGGAGGAACCAATGCTTGC
back to top