CX296852

Overview
NameCX296852
Unique NameCX296852
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length741
Libraries
Library NameType
FerrChloL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX296852_ssr1 microsatellite CX296852_ssr1:1..15. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig720 contig Ccv1_Contig720:1..742. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05803E07SK FerrChloL1 Citrus clementina cDNA clone C05803E07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX296852 ID=CX296852|Name=CX296852|organism=Citrus clementina|type=EST|length=741bp
AAGAAGAAGAAGAAGAGAAAGAAATTTCAATTGCGTGTGGCTTTCTCTCT
CTTCTCTTCTTCTCTCCTATTTCTTTATATCTCTCTTCATTCCTTGCTTT
ATCTTATCTCTGAAGAGAGGAGGAGAGAAAGAAAGAGAAGCATTTTCATT
TTTTTTTATACCAATTAAGAGTAATTACTTCAAATTATTGCTGTTGGCGG
TGCTCCTGTGAAGATGATGGTAGCTAATAGCTTTGATCTATGGAAAAAGG
ACTCCTTTTTTTTCCGCAGCAGAGGAGGTTCAAGAATCAGCTGATATTAT
GGAATCCGCTTACAGATTGTGGGTAAAACAGAAGAACGAAGGTCTAAACC
CAGAGGATTTGAATGAACTCTCAAGGGAACTACAAACTGCTCTTGGTACT
GCTAAATGGCAGCTGGATGAGTTTGAAAGGGCTATCAGGTTGAGCCATGG
ACATTGTCATAATGATTATACAAAAACTAGGCATGGGCAATTTATTGAAG
CCATTGAGAACCAAATTTCTTGTGTGGAAGCAGCATTAAGGGAAGCTTTT
AATGAGGAAGGAAAGCAACCCCTTCGATGGATAGAATTGGATGAAGAGGA
ATGTGATGATTTAGCCATGTTTCTTTCTGGAAATTCCTCCTCCTCATCCA
CTGGGAAAGAAGAATGCGTCAAGTTGACACCTTCTGAGAAAACTCACTTT
TGGAGAACACTCACAGAAATAGATACAGGGCTTATCTTGAT
back to top